Ace Aries Digital Cryptocurrency Dog - Mix of Golder Retriever, Grey Wolf, Shiba Inu, Border Collie, Boxer and Corgi
Ace Aries
  • Purity 12%
  • Age 7 months
  • Racing Exp 1
  • Golder Retriever 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

How you doin? ;) Ace Aries here. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I live life by my favorite quote "Every dog has it's day", but every day is my day! If we can run as a pack for a while, I'm open to that.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.72 sec
Rank 76  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGATACCCCGTAAACAGCAGAAGACCCGTACCC
A
G
A
T
A
C
C
C
C
G
T
A
A
A
C
A
G
C
A
G
A
A
G
A
C
C
C
G
T
A
C
C
C
Genes: 8JLEGO88LEL

Composition

Golder Retriever
27%
Grey Wolf
27%
Shiba Inu
18%
Border Collie
9%
Boxer
9%
Corgi
9%

Current Energy

Vitality -19 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Grey Wolf
Front Legs Shiba Inu
Head Boxer
Ears Corgi
Snout Golder Retriever
Mouth Golder Retriever
Nose Grey Wolf
Eyes Shiba Inu
Color Grey Wolf