Skippy Sara Virtual Crypto Game Dog - Mix of Beagle, Labrador BK, German Shepard, Shiba Inu, Boxer, Rottweiler, French Bulldog, Husky and Poodle
Skippy Sara
  • Purity 5%
  • Age 2 months
  • Racing Exp 8
  • Beagle 18%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

Here in cyberspace, I ain't got much use for a floppy disc. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I like to work out by digging fresh holes in landscaped yards. They say my bite is worse than my bark.

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time16.70 sec
Rank 67  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACTAGTAGCAGCAAACCACCGACTAACAGAC
T
C
A
C
T
A
G
T
A
G
C
A
G
C
A
A
A
C
C
A
C
C
G
A
C
T
A
A
C
A
G
A
C
Genes: 7DE66GH9D4I

Composition

Beagle
18%
Labrador BK
18%
German Shepard
9%
Shiba Inu
9%
Boxer
9%
Rottweiler
9%
French Bulldog
9%
Husky
9%
Poodle
9%

Current Energy

Vitality +6 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Shiba Inu
Front Legs Labrador BK
Head Labrador BK
Ears Boxer
Snout Rottweiler
Mouth French Bulldog
Nose Beagle
Eyes Husky
Color Poodle

Parents

No Children

Photos

virtual dog racing
Gift