Lancelot Lightning Crypto Game Dog - Mix of Shiba Inu, Yorkshire Terrier, Pug, Pitbull terrier, Golder Retriever and German Shepard
Lancelot Lightning
  • Purity 19%
  • Age 7 months
  • Racing Exp 0
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

My name is Lancelot Lightning and I do tricks. Baby, I'm made from the same stuff as dreams. Oh, go ahead. Pet me. I know you want to. I hate having to wear foo-foo clothes and ribbons in my fur. My bark alone scares birds out of my yard. Fun-loving and playful only need apply.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTAGTAGTAGTATTAGAAGTATCCAGATCATTA
T
T
A
G
T
A
G
T
A
G
T
A
T
T
A
G
A
A
G
T
A
T
C
C
A
G
A
T
C
A
T
T
A
Genes: FEEEF2EN87F

Composition

Shiba Inu
36%
Yorkshire Terrier
27%
Pug
9%
Pitbull terrier
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -55 points
Lunar Effect -4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Pug
Snout Shiba Inu
Mouth Pitbull terrier
Nose Golder Retriever
Eyes German Shepard
Color Yorkshire Terrier