Jesse James Jane Bitcoin Dog - Mix of Yorkshire Terrier, Pug, Golder Retriever, Border Collie, French Bulldog, Maltese and Corgi
Jesse James Jane
  • Purity 13%
  • Age 7 months
  • Racing Exp 1
  • Yorkshire Terrier 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

As a digital dog, let me say Bob Dole did not invent the internet. My favorite way to spend playtime is a good game of frisbee. Don't bother contacting me if you like cats. I like to work out by digging fresh holes in landscaped yards. I'm on the lookout for someone willing to stop and smell the catpoop with me.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.10 sec
Rank 71  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTATACCGAACCTTAGAAGAAAGCAGAAGATTA
T
T
A
T
A
C
C
G
A
A
C
C
T
T
A
G
A
A
G
A
A
A
G
C
A
G
A
A
G
A
T
T
A
Genes: FJ9KF22O88F

Composition

Yorkshire Terrier
27%
Pug
18%
Golder Retriever
18%
Border Collie
9%
French Bulldog
9%
Maltese
9%
Corgi
9%

Current Energy

Vitality -57 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Border Collie
Legs French Bulldog
Front Legs Maltese
Head Yorkshire Terrier
Ears Pug
Snout Pug
Mouth Corgi
Nose Golder Retriever
Eyes Golder Retriever
Color Yorkshire Terrier

Parents

No Children

Photos

Gift