Meta Knight Maximus Litecoin Dog - Mix of Yorkshire Terrier, Shiba Inu, Pug, Husky, Maltese, Pitbull terrier, Golder Retriever and German Shepard
Meta Knight Maximus
  • Purity 8%
  • Age 2 months
  • Racing Exp 2
  • Yorkshire Terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 3
Sad & Snaillike

Achievements

Racer

Bio

How's it going? I'm Meta Knight Maximus. Watching kids play without me is the worst, no? Oh, go ahead. Pet me. I know you want to. Creativity is my middle name... I turn everything in to a chew toy. My favorite pastime is playing tug-of-war with my human's underwear.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.80 sec
Rank 68  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTAGTAACAACCTCCGAAGAAGTAAGATCATTA
T
T
A
G
T
A
A
C
A
A
C
C
T
C
C
G
A
A
G
A
A
G
T
A
A
G
A
T
C
A
T
T
A
Genes: FE4KN22E87F

Composition

Yorkshire Terrier
18%
Shiba Inu
18%
Pug
18%
Husky
9%
Maltese
9%
Pitbull terrier
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -16 points
Lunar Effect +8 points

Traits Breakdown

Body Yorkshire Terrier
Tail Shiba Inu
Legs Husky
Front Legs Maltese
Head Pitbull terrier
Ears Pug
Snout Pug
Mouth Shiba Inu
Nose Golder Retriever
Eyes German Shepard
Color Yorkshire Terrier

Parents

No Children

Photos

Gift