Sneak Storm - Crypto Coin Dog
Sneak Storm Bitcoin Dog - Mix of Yorkshire Terrier, Pug, Shiba Inu, French Bulldog, Maltese, Poodle, Golder Retriever and German Shepard
Sneak Storm
  • Purity 9%
  • Age 19 days
  • Racing Exp 1
  • Yorkshire Terrier 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Sad & Tardy

Achievements

Racer

Bio

My favorite treat is to steal the pepperoni off of pizza. Sometimes I forget where I buried my bone. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I'm totally against baths! They are the worst!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.52 sec
Rank 64  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTAGTACGAACCTTAGAAGAAGACAGATCATTA
T
T
A
G
T
A
C
G
A
A
C
C
T
T
A
G
A
A
G
A
A
G
A
C
A
G
A
T
C
A
T
T
A
Genes: FE9KF22I87F

Composition

Yorkshire Terrier
27%
Pug
18%
Shiba Inu
9%
French Bulldog
9%
Maltese
9%
Poodle
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -5 points
Lunar Effect -6 points

Traits Breakdown

Body Yorkshire Terrier
Tail Shiba Inu
Legs French Bulldog
Front Legs Maltese
Head Yorkshire Terrier
Ears Pug
Snout Pug
Mouth Poodle
Nose Golder Retriever
Eyes German Shepard
Color Yorkshire Terrier