Coco Chrissy Crypto Dog - Mix of Pitbull terrier, Husky, Shiba Inu, Golder Retriever, French Bulldog, Maltese and Border Collie
Coco Chrissy
  • Purity 7%
  • Age 6 months
  • Racing Exp 8
  • Pitbull terrier 27%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

Wassup? Yo, call me Coco Chrissy. I am a guard dog for the data warehouse. I like to respond to sad puppy eyes with sad puppy eyes of my own. I'm totally against baths! They are the worst! I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 2 races
  • 0 1 0
 Best Time16.47 sec
Rank 61  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 2 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACATCCACAAGATCCGTATCCGTACGAACCTAC
A
C
A
T
C
C
A
C
A
A
G
A
T
C
C
G
T
A
T
C
C
G
T
A
C
G
A
A
C
C
T
A
C
Genes: 4N48NENE9KJ

Composition

Pitbull terrier
27%
Husky
18%
Shiba Inu
18%
Golder Retriever
9%
French Bulldog
9%
Maltese
9%
Border Collie
9%

Current Energy

Vitality -17 points
Lunar Effect +14 points

Traits Breakdown

Body Husky
Tail Pitbull terrier
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears Shiba Inu
Snout Pitbull terrier
Mouth Shiba Inu
Nose French Bulldog
Eyes Maltese
Color Border Collie