Phoenix Petey Bitcoin Game Dog - Mix of Husky, Shiba Inu, Grey Wolf, Schnauzer, Maltese and Pitbull terrier
Phoenix Petey
  • Purity 17%
  • Age 8 months
  • Racing Exp 9
  • Husky 36%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer
TOP 10 Fastest

Bio

I am a guard dog for the data warehouse. I'm into chasing fast cars, squirrels and my tail. My favorite treat is to steal the pepperoni off of pizza. It turns me on when I can show an older dog a new trick. I'm hoping to find someone who'll howl at the moon with me.

Racing Stats

Ran 2 races
  • 1 0 0
 Best Time14.93 sec
Rank 7  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTACCCATAACAACAGTAACAACCTCCACAGTA
G
T
A
C
C
C
A
T
A
A
C
A
A
C
A
G
T
A
A
C
A
A
C
C
T
C
C
A
C
A
G
T
A
Genes: ELC44E4KN4E

Composition

Husky
36%
Shiba Inu
27%
Grey Wolf
9%
Schnauzer
9%
Maltese
9%
Pitbull terrier
9%

Current Energy

Vitality -25 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail Grey Wolf
Legs Schnauzer
Front Legs Husky
Head Husky
Ears Shiba Inu
Snout Husky
Mouth Maltese
Nose Pitbull terrier
Eyes Husky
Color Shiba Inu

Parents

No Children

Photos

online doggy race photo
Gift