Nutmeg Napoleon Cryptocurrency Dog - Mix of Shiba Inu, Maltese, Husky, Golder Retriever, Labrador and Schnauzer
Nutmeg Napoleon
  • Purity 16%
  • Age 8 months
  • Racing Exp 1
  • Shiba Inu 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hello there, my name is Nutmeg Napoleon. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I've had my nose rubbed in 'it' more than once. I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.75 sec
Rank 78  Racing¬†*** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total¬†*** LTC

DNA Analysis

DNA Sequence: GTAAGACCAACAATAGTAACCACCACCACAGTA
G
T
A
A
G
A
C
C
A
A
C
A
A
T
A
G
T
A
A
C
C
A
C
C
A
C
C
A
C
A
G
T
A
Genes: E854CEKKK4E

Composition

Shiba Inu
27%
Maltese
27%
Husky
18%
Golder Retriever
9%
Labrador
9%
Schnauzer
9%

Current Energy

Vitality -18 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Labrador
Front Legs Husky
Head Schnauzer
Ears Shiba Inu
Snout Maltese
Mouth Maltese
Nose Maltese
Eyes Husky
Color Shiba Inu