Jessie Jazmie Litecoin Dog - Mix of Shiba Inu, Border Collie, Labrador and German Shepard
Jessie Jazmie
  • Purity 32%
  • Age 9 months
  • Racing Exp 0
  • Shiba Inu 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

I love connecting with my friends via pee-mail. Sometimes I forget where I buried my bone. Slipping my collar, running off and making my humans worried? Every chance I get. I don't like having to stay off the furniture. I need someone that "brings home the bacon"!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATACTACTACTACGTACCAGTAGTATCAGTA
G
T
A
T
A
C
T
A
C
T
A
C
T
A
C
G
T
A
C
C
A
G
T
A
G
T
A
T
C
A
G
T
A
Genes: EJJJJE5EE7E

Composition

Shiba Inu
45%
Border Collie
36%
Labrador
9%
German Shepard
9%

Current Energy

Vitality -5 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Shiba Inu
Eyes German Shepard
Color Shiba Inu