Sploot Shere Khan Crypto Dog - Mix of St. Bernard, Maltese, Pitbull terrier, Golder Retriever, Yorkshire Terrier, Schnauzer, Pug and Shiba Inu
Sploot Shere Khan
  • Purity 8%
  • Age 11 months
  • Racing Exp 1
  • St. Bernard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hi! I'm Sploot Shere Khan! I've been known to take mega bytes when playing ruff. What's your favorite bed? Mine is the dirty laundry. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! You scratch my belly and I'll scratch yours ;)

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.25 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGATTATGAACCACCTGAATATCCTCCGAAGTA
A
G
A
T
T
A
T
G
A
A
C
C
A
C
C
T
G
A
A
T
A
T
C
C
T
C
C
G
A
A
G
T
A
Genes: 8FBKKBCNN2E

Composition

St. Bernard
18%
Maltese
18%
Pitbull terrier
18%
Golder Retriever
9%
Yorkshire Terrier
9%
Schnauzer
9%
Pug
9%
Shiba Inu
9%

Current Energy

Vitality -47 points
Lunar Effect +12 points

Traits Breakdown

Body Golder Retriever
Tail Yorkshire Terrier
Legs St. Bernard
Front Legs Maltese
Head Maltese
Ears St. Bernard
Snout Schnauzer
Mouth Pitbull terrier
Nose Pitbull terrier
Eyes Pug
Color Shiba Inu

Parents

No Children

Photos

Gift