Glass Joe Gaston Virtual Crypto Game Dog - Mix of Shiba Inu, Border Collie, Labrador, Schnauzer, Dachshund and German Shepard
Glass Joe Gaston
  • Purity 18%
  • Age 9 months
  • Racing Exp 1
  • Shiba Inu 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

I'm Glass Joe Gaston. How goes it? I live behind a firewall in the Machine. My favorite sport is catching treats my human throws! Once I caught a seagull, but it scared me so I let it go. I don't understand why my human tries to give me tap water. I expect filtered and distilled!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.53 sec
Rank 75  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATACGTATACCCAGTAATAGGAGTATCAGTA
G
T
A
T
A
C
G
T
A
T
A
C
C
C
A
G
T
A
A
T
A
G
G
A
G
T
A
T
C
A
G
T
A
Genes: EJEJ5ECAE7E

Composition

Shiba Inu
45%
Border Collie
18%
Labrador
9%
Schnauzer
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -35 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail Border Collie
Legs Shiba Inu
Front Legs Border Collie
Head Labrador
Ears Shiba Inu
Snout Schnauzer
Mouth Dachshund
Nose Shiba Inu
Eyes German Shepard
Color Shiba Inu

Parents

No Children

Photos

Gift