Kira Khan Digital Cryptocurrency Dog - Mix of Shiba Inu, Border Collie, Maltese, Labrador, Pug and German Shepard
Kira Khan
  • Purity 18%
  • Age 3 months
  • Racing Exp 0
  • Shiba Inu 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Sad & Snaillike

Achievements

None

Bio

Who's a good dog? Hopefully you! Kira Khan here. I'll be honest...Napping is my favorite so we gotta go slow. My turn-offs are rolled up newspapers and loud noises. I'm into chasing fast cars, squirrels and my tail. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATACGTATACACCGTACCAGAAGTATCAGTA
G
T
A
T
A
C
G
T
A
T
A
C
A
C
C
G
T
A
C
C
A
G
A
A
G
T
A
T
C
A
G
T
A
Genes: EJEJKE52E7E

Composition

Shiba Inu
45%
Border Collie
18%
Maltese
9%
Labrador
9%
Pug
9%
German Shepard
9%

Current Energy

Vitality -23 points
Lunar Effect +16 points

Traits Breakdown

Body Shiba Inu
Tail Border Collie
Legs Shiba Inu
Front Legs Border Collie
Head Maltese
Ears Shiba Inu
Snout Labrador
Mouth Pug
Nose Shiba Inu
Eyes German Shepard
Color Shiba Inu