Katz Kate Bitcoin Game Dog - Mix of Shiba Inu, Dachshund, Pug, Husky, Maltese, Labrador and German Shepard
Katz Kate
  • Purity 11%
  • Age 9 months
  • Racing Exp 0
  • Shiba Inu 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

How do you do? I'm Katz Kate. In the big data server, I sorta rule. I don't understand why I like smelling butts... My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I hate having to share my food dish...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGAAGTAACAACCGTACCAGGAGGATCAGGA
G
T
A
G
A
A
G
T
A
A
C
A
A
C
C
G
T
A
C
C
A
G
G
A
G
G
A
T
C
A
G
G
A
Genes: E2E4KE5AA7A

Composition

Shiba Inu
27%
Dachshund
27%
Pug
9%
Husky
9%
Maltese
9%
Labrador
9%
German Shepard
9%

Current Energy

Vitality -40 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail Pug
Legs Shiba Inu
Front Legs Husky
Head Maltese
Ears Shiba Inu
Snout Labrador
Mouth Dachshund
Nose Dachshund
Eyes German Shepard
Color Dachshund