Levi Leisel Crypto Dog - Mix of Shiba Inu, Dachshund, St. Bernard, Husky, Maltese, Corgi and German Shepard
Levi Leisel
  • Purity 11%
  • Age 9 months
  • Racing Exp 0
  • Shiba Inu 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

Hi, Levi Leisel is my name. Currently, I live on the information superhighway. I am not above stealing food off humans' plates. I love a good book... I find them quite tasty. I'm not into dog collars, unless you're into S & M. I need someone that "brings home the bacon"!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATGAGTAACAACCGTAAGCGGAGGATCAGGA
G
T
A
T
G
A
G
T
A
A
C
A
A
C
C
G
T
A
A
G
C
G
G
A
G
G
A
T
C
A
G
G
A
Genes: EBE4KEOAA7A

Composition

Shiba Inu
27%
Dachshund
27%
St. Bernard
9%
Husky
9%
Maltese
9%
Corgi
9%
German Shepard
9%

Current Energy

Vitality -40 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Shiba Inu
Front Legs Husky
Head Maltese
Ears Shiba Inu
Snout Corgi
Mouth Dachshund
Nose Dachshund
Eyes German Shepard
Color Dachshund