Jimmy Chew Jake Bitcoin Dog - Mix of Shiba Inu, Border Collie, Husky, St. Bernard, Labrador, Dachshund and German Shepard
Jimmy Chew Jake
  • Purity 7%
  • Age 20 days
  • Racing Exp 0
  • Shiba Inu 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Casual

Achievements

None

Bio

Barkjour mi amor! I'm Jimmy Chew Jake. I pee when I'm excited. Power outages and computer viruses scare me! I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATGATACACATACGTACCAGTAGGATCAACA
G
T
A
T
G
A
T
A
C
A
C
A
T
A
C
G
T
A
C
C
A
G
T
A
G
G
A
T
C
A
A
C
A
Genes: EBJ4JE5EA74

Composition

Shiba Inu
27%
Border Collie
18%
Husky
18%
St. Bernard
9%
Labrador
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality +50 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Border Collie
Front Legs Husky
Head Border Collie
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Dachshund
Eyes German Shepard
Color Husky