Missie Milo Litecoin Game Dog - Mix of Boxer, Labrador BK, Schnauzer, Beagle, Pitbull terrier, Dachshund, Corgi and Husky
Missie Milo
  • Purity 6%
  • Age 10 months
  • Racing Exp 7
  • Boxer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

I've been looking for love in all the wrong places... Power outages and computer viruses scare me! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! Getting out of a long relationship, not looking for another

Racing Stats

Ran 2 races
  • 0 0 1
 Best Time16.48 sec
Rank 63  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 1 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATCCAACGCAAACATAATAGCAGGAAGCACA
C
T
A
T
C
C
A
A
C
G
C
A
A
A
C
A
T
A
A
T
A
G
C
A
G
G
A
A
G
C
A
C
A
Genes: DNG6GCC6AO4

Composition

Boxer
18%
Labrador BK
18%
Schnauzer
18%
Beagle
9%
Pitbull terrier
9%
Dachshund
9%
Corgi
9%
Husky
9%

Current Energy

Vitality -43 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail Pitbull terrier
Legs Boxer
Front Legs Labrador BK
Head Boxer
Ears Schnauzer
Snout Schnauzer
Mouth Labrador BK
Nose Dachshund
Eyes Corgi
Color Husky

Parents

No Children

Photos

Bitcoin doggy race podium
Gift