Phoenix Paris Crypto Dog - Mix of German Shepard, Pitbull terrier, Pug, Border Collie, Rottweiler, Shiba Inu, Corgi, Maltese and Labrador
Phoenix Paris
  • Purity 3%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Hey, Baby. I'm Phoenix Paris. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) Squeaky toys are the best, don't you agree? As long as we are headed in the same direction, I say we try hanging out for a while.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAGAATCATACCACTCCGTAAGCACCTCCCCA
T
C
A
G
A
A
T
C
A
T
A
C
C
A
C
T
C
C
G
T
A
A
G
C
A
C
C
T
C
C
C
C
A
Genes: 727JHNEOKN5

Composition

German Shepard
18%
Pitbull terrier
18%
Pug
9%
Border Collie
9%
Rottweiler
9%
Shiba Inu
9%
Corgi
9%
Maltese
9%
Labrador
9%

Current Energy

Vitality +7 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs German Shepard
Front Legs Border Collie
Head Rottweiler
Ears Pitbull terrier
Snout Shiba Inu
Mouth Corgi
Nose Maltese
Eyes Pitbull terrier
Color Labrador

Parents

No Children

Gift