Waffles Wiggles Cryptocurrency Dog - Mix of Golder Retriever, Labrador, Shiba Inu, Maltese, Dachshund, Pitbull terrier and Beagle
Waffles Wiggles
  • Purity 12%
  • Age 10 months
  • Racing Exp 0
  • Golder Retriever 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

I'm Waffles Wiggles and I'd like to show you a trick or two. I'm all about a hard drive because you can't do anything with a floppy disc. I could spend days on end chasing my tail. I get so close but it's just so fast! My turn-offs are rolled up newspapers and loud noises.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAAGACCACCACCAAGAACCGGATCCCTAAGA
G
T
A
A
G
A
C
C
A
C
C
A
C
C
A
A
G
A
A
C
C
G
G
A
T
C
C
C
T
A
A
G
A
Genes: E85558KAND8

Composition

Golder Retriever
27%
Labrador
27%
Shiba Inu
9%
Maltese
9%
Dachshund
9%
Pitbull terrier
9%
Beagle
9%

Current Energy

Vitality -26 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Golder Retriever
Snout Maltese
Mouth Dachshund
Nose Pitbull terrier
Eyes Beagle
Color Golder Retriever