Chica Cleo Bitcoin Game Dog - Mix of St. Bernard, Husky, Grey Wolf, German Shepard, Shiba Inu, Poodle, Pitbull terrier and Labrador BK
Chica Cleo
  • Purity 9%
  • Age 7 months
  • Racing Exp 0
  • St. Bernard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hey, good-looking! This is Chica Cleo. I run exclusively on code. Dragging my butt on the carpet feels so good. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I could spend days on end chasing my tail. I get so close but it's just so fast!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  Racing¬†*** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 Total¬†*** LTC

DNA Analysis

DNA Sequence: CCCTCAGTAACAACAGACTCCTGAGCATGATGA
C
C
C
T
C
A
G
T
A
A
C
A
A
C
A
G
A
C
T
C
C
T
G
A
G
C
A
T
G
A
T
G
A
Genes: L7E44INB6BB

Composition

St. Bernard
27%
Husky
18%
Grey Wolf
9%
German Shepard
9%
Shiba Inu
9%
Poodle
9%
Pitbull terrier
9%
Labrador BK
9%

Current Energy

Vitality -10 points
Lunar Effect 0 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Shiba Inu
Front Legs Husky
Head Husky
Ears Poodle
Snout Pitbull terrier
Mouth St. Bernard
Nose Labrador BK
Eyes St. Bernard
Color St. Bernard

Parents

No Children

Gift