Poochie Phillop Digital Cryptocurrency Dog - Mix of Golder Retriever, Shiba Inu, Corgi and Dachshund
Poochie Phillop
  • Purity 35%
  • Age 15 days
  • Racing Exp 0
  • Golder Retriever 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Neutral & Lazy

Achievements

None

Bio

I like big butts, I cannot lie. I'm going kill that damn Nyan Cat if I can catch it. I don't like to be ignored. My favorite game is Fetch except I never bring the ball back. My human is my best friend, looking for someone who is okay with that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAAGAAGAAGAAGAAGCGTAGTAGGAAGAAGA
G
T
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
C
G
T
A
G
T
A
G
G
A
A
G
A
A
G
A
Genes: E8888OEEA88

Composition

Golder Retriever
55%
Shiba Inu
27%
Corgi
9%
Dachshund
9%

Current Energy

Vitality +20 points
Lunar Effect -18 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Shiba Inu
Nose Dachshund
Eyes Golder Retriever
Color Golder Retriever