Mary Mia Litecoin Dog - Mix of Labrador, Dachshund, German Shepard, Rottweiler, Golder Retriever, Pug, Grey Wolf, St. Bernard and Husky
Mary Mia
  • Purity 3%
  • Age 44 days
  • Racing Exp 0
  • Labrador 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Neutral & Casual

Achievements

None

Bio

How's it going? I'm Mary Mia. I don't mind sharing my bed with someone I just met, if we can cuddle. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I need to find someone tuff to help me protect our pups from that scheming mailman!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCATCACACAGACCAGAAGGACCCTGAACAGGA
C
C
A
T
C
A
C
A
C
A
G
A
C
C
A
G
A
A
G
G
A
C
C
C
T
G
A
A
C
A
G
G
A
Genes: 57H852ALB4A

Composition

Labrador
18%
Dachshund
18%
German Shepard
9%
Rottweiler
9%
Golder Retriever
9%
Pug
9%
Grey Wolf
9%
St. Bernard
9%
Husky
9%

Current Energy

Vitality +26 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador
Tail German Shepard
Legs Rottweiler
Front Legs Golder Retriever
Head Labrador
Ears Pug
Snout Dachshund
Mouth Grey Wolf
Nose St. Bernard
Eyes Husky
Color Dachshund

Parents

No Children

Gift