Kujo Kobe Bitcoin Dog - Mix of Dachshund, German Shepard, Corgi, Rottweiler, Labrador BK, Pug, Grey Wolf, Husky and Labrador
Kujo Kobe
  • Purity 8%
  • Age 10 months
  • Racing Exp 0
  • Dachshund 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Wassup? Yo, call me Kujo Kobe. I'm having some new data architecture built for me, then I'd like to have you over to my place. I love a good book... I find them quite tasty. My idea of romance would be to stroll through in the dog park then share a meaty bone with you.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAAGCCACGCAGGAGGAGGAGAACCCACACCA
T
C
A
A
G
C
C
A
C
G
C
A
G
G
A
G
G
A
G
G
A
G
A
A
C
C
C
A
C
A
C
C
A
Genes: 7OH6AAA2L45

Composition

Dachshund
27%
German Shepard
9%
Corgi
9%
Rottweiler
9%
Labrador BK
9%
Pug
9%
Grey Wolf
9%
Husky
9%
Labrador
9%

Current Energy

Vitality -11 points
Lunar Effect -16 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Rottweiler
Front Legs Labrador BK
Head Dachshund
Ears Dachshund
Snout Dachshund
Mouth Pug
Nose Grey Wolf
Eyes Husky
Color Labrador