Whiz Waffles Crypto Game Dog - Mix of Golder Retriever, Pitbull terrier, Shiba Inu, Labrador, Maltese and St. Bernard
Whiz Waffles
  • Purity 20%
  • Age 3 months
  • Racing Exp 1
  • Golder Retriever 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 3
Sad & Tardy

Achievements

Racer

Bio

Nyan Cat is my best friend here in the cyberspace. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I'm going kill that damn Nyan Cat if I can catch it. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.92 sec
Rank 69  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAAGACCATCCAGAAGAACCTGATCCAGAAGA
G
T
A
A
G
A
C
C
A
T
C
C
A
G
A
A
G
A
A
C
C
T
G
A
T
C
C
A
G
A
A
G
A
Genes: E85N88KBN88

Composition

Golder Retriever
45%
Pitbull terrier
18%
Shiba Inu
9%
Labrador
9%
Maltese
9%
St. Bernard
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Labrador
Front Legs Pitbull terrier
Head Golder Retriever
Ears Golder Retriever
Snout Maltese
Mouth St. Bernard
Nose Pitbull terrier
Eyes Golder Retriever
Color Golder Retriever