Shamus Steffi Bitcoin Dog - Mix of Shiba Inu, Beagle, St. Bernard, French Bulldog, Boxer, Pug and Labrador
Shamus Steffi
  • Purity 20%
  • Age 46 days
  • Racing Exp 1
  • Shiba Inu 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 3
Neutral & Casual

Achievements

Racer

Bio

How do you do? I'm Shamus Steffi. I hate it when my human runs out of poop-bags. How embarrassing! Squeaky toys are the best, don't you agree? When I hook up, I stay hooked up for about 20 minutes. My human says I'm loyal, intelligent, devoted and affectionate. I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.80 sec
Rank 55  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATGAGTAGTACGAAACGTAGTAGTAGAACCA
C
T
A
T
G
A
G
T
A
G
T
A
C
G
A
A
A
C
G
T
A
G
T
A
G
T
A
G
A
A
C
C
A
Genes: DBEE9GEEE25

Composition

Shiba Inu
45%
Beagle
9%
St. Bernard
9%
French Bulldog
9%
Boxer
9%
Pug
9%
Labrador
9%

Current Energy

Vitality -8 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail St. Bernard
Legs Shiba Inu
Front Legs Shiba Inu
Head French Bulldog
Ears Boxer
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Pug
Color Labrador

Parents

No Children

Photos

Gift