Mowgli Misty Cryptocurrency Dog - Mix of Golder Retriever, Beagle, Rottweiler, German Shepard, Pitbull terrier and Shiba Inu
Mowgli Misty
  • Purity 13%
  • Age 46 days
  • Racing Exp 0
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Ecstatic & Fast

Achievements

None

Bio

I hate it when my human runs out of poop-bags. How embarrassing! I like giving wet kisses. I never met a crotch or a butt I didn't like, but I'm just friendly that way. My favorite sport is catching treats my human throws! I am looking for dogs I can run around town with...not looking for exclusivity.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAAGACTATCCAGACACGTACTACACAGAAGA
T
C
A
A
G
A
C
T
A
T
C
C
A
G
A
C
A
C
G
T
A
C
T
A
C
A
C
A
G
A
A
G
A
Genes: 78DN8HEDH88

Composition

Golder Retriever
36%
Beagle
18%
Rottweiler
18%
German Shepard
9%
Pitbull terrier
9%
Shiba Inu
9%

Current Energy

Vitality +3 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Golder Retriever
Legs Beagle
Front Legs Pitbull terrier
Head Golder Retriever
Ears Rottweiler
Snout Shiba Inu
Mouth Beagle
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever