T-Bird Teddybear Litecoin Dog - Mix of Golder Retriever, Poodle, Pitbull terrier, Corgi, Shiba Inu and Border Collie
T-Bird Teddybear
  • Purity 27%
  • Age 17 days
  • Racing Exp 0
  • Golder Retriever 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Neutral & Lazy

Achievements

None

Bio

Greetings. My name is T-Bird Teddybear. My favorite chews are underwear and rawhide...the rawhide lasts longer. I hate bubble baths; mud puddles are more my style. I'd like to help you shed your coat, baby. I'm looking for someone who is also playful, feisty and happy.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACAGAAGATCCAGAAGCGTATACAGAAGAAGA
G
A
C
A
G
A
A
G
A
T
C
C
A
G
A
A
G
C
G
T
A
T
A
C
A
G
A
A
G
A
A
G
A
Genes: I88N8OEJ888

Composition

Golder Retriever
55%
Poodle
9%
Pitbull terrier
9%
Corgi
9%
Shiba Inu
9%
Border Collie
9%

Current Energy

Vitality +12 points
Lunar Effect -18 points

Traits Breakdown

Body Poodle
Tail Golder Retriever
Legs Golder Retriever
Front Legs Pitbull terrier
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Border Collie
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever