Moose Mario Cryptocurrency Dog - Mix of Beagle, Boxer, Schnauzer, Dachshund, Labrador BK, Rottweiler, Labrador, Maltese, Corgi and Yorkshire Terrier
Moose Mario
  • Purity 3%
  • Age 47 days
  • Racing Exp 7
  • Beagle 18%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 1
Neutral & Casual

Achievements

Racer

Bio

I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. Chasing anything that will run is so much fun, I could do that all day. I like giving wet kisses. I hate hiding under the bed during a thunder storm but that's just smart, right?

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time16.65 sec
Rank 51  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACATAGGAGCACTACTACACCCAACCAGCTTA
A
A
C
A
T
A
G
G
A
G
C
A
C
T
A
C
T
A
C
A
C
C
C
A
A
C
C
A
G
C
T
T
A
Genes: GCA6DDH5KOF

Composition

Beagle
18%
Boxer
9%
Schnauzer
9%
Dachshund
9%
Labrador BK
9%
Rottweiler
9%
Labrador
9%
Maltese
9%
Corgi
9%
Yorkshire Terrier
9%

Current Energy

Vitality +12 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Dachshund
Front Legs Labrador BK
Head Beagle
Ears Beagle
Snout Rottweiler
Mouth Labrador
Nose Maltese
Eyes Corgi
Color Yorkshire Terrier

Parents

No Children

Photos

Bitcoin pet race
Gift