Kong Kirby Litecoin Game Dog - Mix of Golder Retriever, Shiba Inu, Dachshund, German Shepard and Corgi
Kong Kirby
  • Purity 20%
  • Age 3 months
  • Racing Exp 2
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 4
Sad & Tardy

Achievements

Racer

Bio

Howdy there. I'm Kong Kirby. Taking a break from chasing Nyan Cat around cyberspace. I love car rides when I can stick my head out the window. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.60 sec
Rank 65  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATCAAGAAGAAGAAGCGTAGTAGGAAGAGGA
G
T
A
T
C
A
A
G
A
A
G
A
A
G
A
A
G
C
G
T
A
G
T
A
G
G
A
A
G
A
G
G
A
Genes: E7888OEEA8A

Composition

Golder Retriever
36%
Shiba Inu
27%
Dachshund
18%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -19 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail German Shepard
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Shiba Inu
Nose Dachshund
Eyes Golder Retriever
Color Dachshund