Ninja Nike Crypto Dog - Mix of French Bulldog, Labrador, Husky, German Shepard, Pug, Shiba Inu, Beagle, Maltese and St. Bernard
Ninja Nike
  • Purity 5%
  • Age 11 months
  • Racing Exp 1
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

My name is Ninja Nike and I'd really like to sniff you. I'm into leather...if I have the right partner. I hate it when humans put the lid down. I like to work out by digging fresh holes in landscaped yards. If you are looking for companionship without commitment, keep looking.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.22 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACATCAGAAGTACGACTACGAACCTGACCACCA
A
C
A
T
C
A
G
A
A
G
T
A
C
G
A
C
T
A
C
G
A
A
C
C
T
G
A
C
C
A
C
C
A
Genes: 472E9D9KB55

Composition

French Bulldog
18%
Labrador
18%
Husky
9%
German Shepard
9%
Pug
9%
Shiba Inu
9%
Beagle
9%
Maltese
9%
St. Bernard
9%

Current Energy

Vitality -50 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Pug
Front Legs Shiba Inu
Head French Bulldog
Ears Beagle
Snout French Bulldog
Mouth Maltese
Nose St. Bernard
Eyes Labrador
Color Labrador