Libby Lady Rover Digital Cryptocurrency Dog - Mix of Shiba Inu, Labrador, Schnauzer, German Shepard, Labrador BK, Beagle and Yorkshire Terrier
Libby Lady Rover
  • Purity 12%
  • Age 10 months
  • Racing Exp 0
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Depressed & Snaillike

Achievements

None

Bio

My favorite position is doggie style ;) I like giving wet kisses. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I'll eat my vomit and yours too. Getting out of a long relationship, not looking for another

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAATATCAGCAGTAGTACCAGTACCACTATTA
G
T
A
A
T
A
T
C
A
G
C
A
G
T
A
G
T
A
C
C
A
G
T
A
C
C
A
C
T
A
T
T
A
Genes: EC76EE5E5DF

Composition

Shiba Inu
36%
Labrador
18%
Schnauzer
9%
German Shepard
9%
Labrador BK
9%
Beagle
9%
Yorkshire Terrier
9%

Current Energy

Vitality -10 points
Lunar Effect -14 points

Traits Breakdown

Body Shiba Inu
Tail Schnauzer
Legs German Shepard
Front Legs Labrador BK
Head Shiba Inu
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Labrador
Eyes Beagle
Color Yorkshire Terrier

Parents

No Children

Gift