Shelly Simone Litecoin Dog - Mix of Shiba Inu, German Shepard, French Bulldog, Rottweiler, Corgi and Beagle
Shelly Simone
  • Purity 13%
  • Age 50 days
  • Racing Exp 0
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Neutral & Casual

Achievements

None

Bio

Barkjour mi amor! I'm Shelly Simone. When I can break free, I enjoy exploring my neighborhood without my human. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I'm looking for some ruff play. Wanna bite me?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATCACGATCAGTAGTACACGTAAGCCTACGA
G
T
A
T
C
A
C
G
A
T
C
A
G
T
A
G
T
A
C
A
C
G
T
A
A
G
C
C
T
A
C
G
A
Genes: E797EEHEOD9

Composition

Shiba Inu
36%
German Shepard
18%
French Bulldog
18%
Rottweiler
9%
Corgi
9%
Beagle
9%

Current Energy

Vitality +15 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail German Shepard
Legs French Bulldog
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout Rottweiler
Mouth Shiba Inu
Nose Corgi
Eyes Beagle
Color French Bulldog

Parents

No Children

Gift