Jamie Jago - Virtual Racing Dog
Jamie Jago Crypto Dog - Mix of Shiba Inu, German Shepard, Labrador, Beagle and French Bulldog
Jamie Jago
  • Purity 20%
  • Age 3 months
  • Racing Exp 0
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Tardy

Achievements

None

Bio

I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! My humans should try spending 8 hours a day in a crate! If I can't reach it to clean it myself, it doesn't need cleaning! I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATCATCATCAGTAGTACCAGTACCACTACGA
G
T
A
T
C
A
T
C
A
T
C
A
G
T
A
G
T
A
C
C
A
G
T
A
C
C
A
C
T
A
C
G
A
Genes: E777EE5E5D9

Composition

Shiba Inu
36%
German Shepard
27%
Labrador
18%
Beagle
9%
French Bulldog
9%

Current Energy

Vitality -12 points
Lunar Effect +10 points

Traits Breakdown

Body Shiba Inu
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Labrador
Eyes Beagle
Color French Bulldog