Evan Emily Bitcoin Dog - Mix of Golder Retriever, Labrador BK, Shiba Inu, Beagle, Labrador and French Bulldog
Evan Emily
  • Purity 29%
  • Age 2 months
  • Racing Exp 0
  • Golder Retriever 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Happy & Agile

Achievements

None

Bio

You can call me Evan Emily, everybody else does. You can access my database anytime with your WiFi. When my human brushes my coat, I get frisky! If I had to pick a favorite food it would be a hot-dog, because you are what you eat! Getting out of a long relationship, not looking for another

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAAGAAGAAGAAGAAGAGTACTACCAAGACGA
G
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
G
T
A
C
T
A
C
C
A
A
G
A
C
G
A
Genes: 688888ED589

Composition

Golder Retriever
55%
Labrador BK
9%
Shiba Inu
9%
Beagle
9%
Labrador
9%
French Bulldog
9%

Current Energy

Vitality -23 points
Lunar Effect -18 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Golder Retriever
Snout Shiba Inu
Mouth Beagle
Nose Labrador
Eyes Golder Retriever
Color French Bulldog