Keaton Knuckleball Crypto Game Dog - Mix of Golder Retriever, Labrador, Labrador BK, Yorkshire Terrier and French Bulldog
Keaton Knuckleball
  • Purity 31%
  • Age 50 days
  • Racing Exp 0
  • Golder Retriever 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Neutral & Casual

Achievements

None

Bio

What's up? I'm Keaton Knuckleball. It turns me on when I can show an older dog a new trick. My humans should try spending 8 hours a day in a crate! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I like to respond to sad puppy eyes with sad puppy eyes of my own.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAAGAAGAAGAAGAAGACCATTACCAAGACGA
G
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
C
C
A
T
T
A
C
C
A
A
G
A
C
G
A
Genes: 6888885F589

Composition

Golder Retriever
55%
Labrador
18%
Labrador BK
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality +12 points
Lunar Effect -18 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Golder Retriever
Snout Labrador
Mouth Yorkshire Terrier
Nose Labrador
Eyes Golder Retriever
Color French Bulldog