Godiva Georgie - Racing Dog
Godiva Georgie Cryptocurrency Dog - Mix of Husky, Beagle, Pitbull terrier, Boxer, Schnauzer, French Bulldog, Labrador BK and Corgi
Godiva Georgie
  • Purity 4%
  • Age 3 months
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Sad & Tardy

Achievements

None

Bio

I'm Godiva Georgie and I'd like to show you a trick or two. The internet's my home. I'll outrun you for the ball if I can...that's just how I roll. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACATACGAGCAACACTAACACTATCCAGCTCC
A
A
C
A
T
A
C
G
A
G
C
A
A
C
A
C
T
A
A
C
A
C
T
A
T
C
C
A
G
C
T
C
C
Genes: GC964D4DNON

Composition

Husky
18%
Beagle
18%
Pitbull terrier
18%
Boxer
9%
Schnauzer
9%
French Bulldog
9%
Labrador BK
9%
Corgi
9%

Current Energy

Vitality -25 points
Lunar Effect +2 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs French Bulldog
Front Legs Labrador BK
Head Husky
Ears Beagle
Snout Husky
Mouth Beagle
Nose Pitbull terrier
Eyes Corgi
Color Pitbull terrier