Aldo Archibald Litecoin Dog - Mix of Golder Retriever, Pitbull terrier, Husky, Border Collie, Corgi, Shiba Inu, Beagle and Rottweiler
Aldo Archibald
  • Purity 11%
  • Age 27 days
  • Racing Exp 0
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Sad & Tardy

Achievements

None

Bio

Hello, there. Aldo Archibald here. Shy dogs that tuck tail bore me. I really enjoy heavy petting. Steak is my absolute favorite, but I prefer to eat chicken for my health. I love it when you show a little teeth.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCAGAACATACAGAAGCGTACTACACAGAAGA
T
C
C
A
G
A
A
C
A
T
A
C
A
G
A
A
G
C
G
T
A
C
T
A
C
A
C
A
G
A
A
G
A
Genes: N84J8OEDH88

Composition

Golder Retriever
36%
Pitbull terrier
9%
Husky
9%
Border Collie
9%
Corgi
9%
Shiba Inu
9%
Beagle
9%
Rottweiler
9%

Current Energy

Vitality +26 points
Lunar Effect -10 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Husky
Front Legs Border Collie
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Beagle
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever