Biggie Boba Fett Cryptocurrency Dog - Mix of Golder Retriever, Husky, Pitbull terrier, Border Collie, Labrador, Shiba Inu and Rottweiler
Biggie Boba Fett
  • Purity 12%
  • Age 5 months
  • Racing Exp 0
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Sad & Snaillike

Achievements

None

Bio

It's a barkin' beautiful day! Biggie Boba Fett here. I'm always up for a nice long walk around the neighborhood. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCAGAACATACAGACCAGTAACACACAGAAGA
T
C
C
A
G
A
A
C
A
T
A
C
A
G
A
C
C
A
G
T
A
A
C
A
C
A
C
A
G
A
A
G
A
Genes: N84J85E4H88

Composition

Golder Retriever
36%
Husky
18%
Pitbull terrier
9%
Border Collie
9%
Labrador
9%
Shiba Inu
9%
Rottweiler
9%

Current Energy

Vitality -34 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Husky
Front Legs Border Collie
Head Golder Retriever
Ears Labrador
Snout Shiba Inu
Mouth Husky
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever