Brit Boomer - Litecoin Coin Dog
Brit Boomer Litecoin Game Dog - Mix of Golder Retriever, Labrador, Beagle, Husky, Dachshund and Rottweiler
Brit Boomer
  • Purity 13%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Sad & Tardy

Achievements

None

Bio

In my humble opinion the best toy is one of my human's stinky, old socks. I really enjoy heavy petting. I've been known to run with bad dogs. I hate it when other dogs pee in my yard! IT'S MY YARD!! Fun-loving and playful only need apply.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAAGAACACTAAGACCAGGACTACACAGAAGA
C
C
A
A
G
A
A
C
A
C
T
A
A
G
A
C
C
A
G
G
A
C
T
A
C
A
C
A
G
A
A
G
A
Genes: 584D85ADH88

Composition

Golder Retriever
36%
Labrador
18%
Beagle
18%
Husky
9%
Dachshund
9%
Rottweiler
9%

Current Energy

Vitality -25 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Golder Retriever
Legs Husky
Front Legs Beagle
Head Golder Retriever
Ears Labrador
Snout Dachshund
Mouth Beagle
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever