Jiminy Jak Crypto Dog - Mix of Boxer, Golder Retriever, Labrador, Rottweiler, Yorkshire Terrier, German Shepard, French Bulldog, Beagle, Husky and Dachshund
Jiminy Jak
  • Purity 1%
  • Age 4 months
  • Racing Exp 1
  • Boxer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Good day to you! I'm Jiminy Jak! Someday I'm gonna breakout from inside this server. I love the smell of freshly cut grass. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! Removing excess stuffing from pillows is my favorite hobby.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.62 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGACCAAACCACAACTTATCACGACTAACAGGA
A
G
A
C
C
A
A
A
C
C
A
C
A
A
C
T
T
A
T
C
A
C
G
A
C
T
A
A
C
A
G
G
A
Genes: 85GHGF79D4A

Composition

Boxer
18%
Golder Retriever
9%
Labrador
9%
Rottweiler
9%
Yorkshire Terrier
9%
German Shepard
9%
French Bulldog
9%
Beagle
9%
Husky
9%
Dachshund
9%

Current Energy

Vitality -32 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs Boxer
Front Legs Rottweiler
Head Boxer
Ears Yorkshire Terrier
Snout German Shepard
Mouth French Bulldog
Nose Beagle
Eyes Husky
Color Dachshund