Munchkin Mimi - Cryptocurrency Dog
Munchkin Mimi Bitcoin Game Dog - Mix of Husky, Pitbull terrier, French Bulldog, Grey Wolf, Schnauzer, St. Bernard, German Shepard, Beagle and Poodle
Munchkin Mimi
  • Purity 3%
  • Age 4 months
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

Hello, I'm Munchkin Mimi. How's it goin'? I run with a pack in the data warehouse. I need laid otherwise I'm going to start agreeing with Grumpy Cat. My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm ready to settle down and have puppies...what about you?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGACCCATATGAACATCAACACTATCCGACTCC
C
G
A
C
C
C
A
T
A
T
G
A
A
C
A
T
C
A
A
C
A
C
T
A
T
C
C
G
A
C
T
C
C
Genes: 9LCB474DNIN

Composition

Husky
18%
Pitbull terrier
18%
French Bulldog
9%
Grey Wolf
9%
Schnauzer
9%
St. Bernard
9%
German Shepard
9%
Beagle
9%
Poodle
9%

Current Energy

Vitality -41 points
Lunar Effect +6 points

Traits Breakdown

Body French Bulldog
Tail Grey Wolf
Legs Schnauzer
Front Legs St. Bernard
Head Husky
Ears German Shepard
Snout Husky
Mouth Beagle
Nose Pitbull terrier
Eyes Poodle
Color Pitbull terrier