Verona Viva - Crypto Racing Dog
Verona Viva Digital Cryptocurrency Dog - Mix of Beagle, Corgi, Boxer, Schnauzer, French Bulldog, Labrador BK, Rottweiler, Dachshund and Yorkshire Terrier
Verona Viva
  • Purity 7%
  • Age 4 months
  • Racing Exp 0
  • Beagle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Top o' the mornin' to ya! I'm Verona Viva. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I need laid otherwise I'm going to start agreeing with Grumpy Cat. My human is my best friend, looking for someone who is okay with that.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 2 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACATACGAGCACTACTACACGGAAGCAGCTTA
A
A
C
A
T
A
C
G
A
G
C
A
C
T
A
C
T
A
C
A
C
G
G
A
A
G
C
A
G
C
T
T
A
Genes: GC96DDHAOOF

Composition

Beagle
18%
Corgi
18%
Boxer
9%
Schnauzer
9%
French Bulldog
9%
Labrador BK
9%
Rottweiler
9%
Dachshund
9%
Yorkshire Terrier
9%

Current Energy

Vitality -25 points
Lunar Effect -2 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs French Bulldog
Front Legs Labrador BK
Head Beagle
Ears Beagle
Snout Rottweiler
Mouth Dachshund
Nose Corgi
Eyes Corgi
Color Yorkshire Terrier