Emmie Elliot Litecoin Dog - Mix of Grey Wolf, Border Collie, German Shepard, Yorkshire Terrier, Dachshund, Shiba Inu, Labrador BK, Golder Retriever and Poodle
Emmie Elliot
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

I've always had a crush on Lassie. Don't bother contacting me if you like cats. I enjoy chasing my tail around. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I'm just looking for some puppy love.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCTCATACCCCTTAGGAGTAGCATACAGAGAC
C
C
C
T
C
A
T
A
C
C
C
C
T
T
A
G
G
A
G
T
A
G
C
A
T
A
C
A
G
A
G
A
C
Genes: L7JLFAE6J8I

Composition

Grey Wolf
18%
Border Collie
18%
German Shepard
9%
Yorkshire Terrier
9%
Dachshund
9%
Shiba Inu
9%
Labrador BK
9%
Golder Retriever
9%
Poodle
9%

Current Energy

Vitality 0 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Border Collie
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Dachshund
Snout Shiba Inu
Mouth Labrador BK
Nose Border Collie
Eyes Golder Retriever
Color Poodle