Basket Big Boss Litecoin Game Dog - Mix of German Shepard, Labrador, Husky, Rottweiler, Golder Retriever, Yorkshire Terrier, Dachshund and French Bulldog
Basket Big Boss
  • Purity 9%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Size matters. This dawg's into big databases. I think hamsters and cats are both over-rated. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 2 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACACACTCATCATCAAGACCATTACCAGGACGA
A
C
A
C
A
C
T
C
A
T
C
A
T
C
A
A
G
A
C
C
A
T
T
A
C
C
A
G
G
A
C
G
A
Genes: 4H77785F5A9

Composition

German Shepard
27%
Labrador
18%
Husky
9%
Rottweiler
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Dachshund
9%
French Bulldog
9%

Current Energy

Vitality -2 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Rottweiler
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Golder Retriever
Snout Labrador
Mouth Yorkshire Terrier
Nose Labrador
Eyes Dachshund
Color French Bulldog