Betsy Beast Digital Cryptocurrency Game Dog - Mix of Labrador, Boxer, Husky, Beagle, Dachshund, Labrador BK, German Shepard and Corgi
Betsy Beast
  • Purity 11%
  • Age 7 days
  • Racing Exp 0
  • Labrador 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Howdy there. I'm Betsy Beast. My AI may be artificial, but at least I'm intelligent. I like it when you're frisky. I'm sick of having my nails clipped, those are to help me dig! I never met a crotch or a butt I didn't like, but I'm just friendly that way. I want to find a mate who enjoys dog parks as much as I do.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAAACACACTACCACCAGGAGCATCACCAAGC
C
C
A
A
A
C
A
C
A
C
T
A
C
C
A
C
C
A
G
G
A
G
C
A
T
C
A
C
C
A
A
G
C
Genes: 5G4D55A675O

Composition

Labrador
36%
Boxer
9%
Husky
9%
Beagle
9%
Dachshund
9%
Labrador BK
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality +24 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Boxer
Legs Husky
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Dachshund
Mouth Labrador BK
Nose German Shepard
Eyes Labrador
Color Corgi

Parents

No Children

Gift