Fifi Fluff Litecoin Dog - Mix of Dachshund, Labrador BK, German Shepard, Pug, French Bulldog, Shiba Inu, Boxer, Corgi and Husky
Fifi Fluff
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Dachshund 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Tardy

Achievements

None

Bio

I'm going kill that damn Nyan Cat if I can catch it. I enjoy staying active, and running circles around puppies and young children. Power outages and computer viruses scare me! The place I like most in the world is curled up in my human's bed, hogging all the covers!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCATCAGAACGAGTAAACAGCGGAGGAACAGGA
G
C
A
T
C
A
G
A
A
C
G
A
G
T
A
A
A
C
A
G
C
G
G
A
G
G
A
A
C
A
G
G
A
Genes: 6729EGOAA4A

Composition

Dachshund
27%
Labrador BK
9%
German Shepard
9%
Pug
9%
French Bulldog
9%
Shiba Inu
9%
Boxer
9%
Corgi
9%
Husky
9%

Current Energy

Vitality -24 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Pug
Front Legs French Bulldog
Head Shiba Inu
Ears Boxer
Snout Corgi
Mouth Dachshund
Nose Dachshund
Eyes Husky
Color Dachshund