Guido Great Tiger Digital Cryptocurrency Dog - Mix of St. Bernard, Border Collie, Labrador BK, German Shepard, Labrador, Maltese, Yorkshire Terrier and Golder Retriever
Guido Great Tiger
  • Purity 4%
  • Age 11 months
  • Racing Exp 0
  • St. Bernard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Yo dog! Guido Great Tiger here. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I like it when you're frisky. I never knew my father. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATGATACGCACCATACACCTTAGCAAGATGA
T
C
A
T
G
A
T
A
C
G
C
A
C
C
A
T
A
C
A
C
C
T
T
A
G
C
A
A
G
A
T
G
A
Genes: 7BJ65JKF68B

Composition

St. Bernard
18%
Border Collie
18%
Labrador BK
18%
German Shepard
9%
Labrador
9%
Maltese
9%
Yorkshire Terrier
9%
Golder Retriever
9%

Current Energy

Vitality -11 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs Border Collie
Front Legs Labrador BK
Head Labrador
Ears Border Collie
Snout Maltese
Mouth Yorkshire Terrier
Nose Labrador BK
Eyes Golder Retriever
Color St. Bernard

Parents

No Children

Gift