Skyler Spud - Virtual Dog
Skyler Spud Crypto Dog - Mix of Golder Retriever, Labrador, Grey Wolf, Pitbull terrier, Corgi and Rottweiler
Skyler Spud
  • Purity 18%
  • Age 4 months
  • Racing Exp 0
  • Golder Retriever 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Sad & Tardy

Achievements

None

Bio

I am a web of clouds kind of dog. You know the worst? Watching my humans 'get it on' and I have to lick myself. As a designer, I suggest low windows or couch backs next to windows without curtains. I am looking for my best friend, lover, and equal partner to share my food bowl.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCAGACCATCCAGAAGCAGACCACACAGAAGA
C
C
C
A
G
A
C
C
A
T
C
C
A
G
A
A
G
C
A
G
A
C
C
A
C
A
C
A
G
A
A
G
A
Genes: L85N8O85H88

Composition

Golder Retriever
45%
Labrador
18%
Grey Wolf
9%
Pitbull terrier
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality -29 points
Lunar Effect +8 points

Traits Breakdown

Body Grey Wolf
Tail Golder Retriever
Legs Labrador
Front Legs Pitbull terrier
Head Golder Retriever
Ears Corgi
Snout Golder Retriever
Mouth Labrador
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever