Maximus Mulligan Litecoin Dog - Mix of Corgi, Labrador, Dachshund, Pug, German Shepard, Pitbull terrier, Beagle, Boxer and Yorkshire Terrier
Maximus Mulligan
  • Purity 3%
  • Age 19 months
  • Racing Exp 1
  • Corgi 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

Hi, I'm Maximus Mulligan. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. It turns me on when I can show an older dog a new trick. I like to play fetch with a tennis ball. If we can run as a pack for a while, I'm open to that.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.88 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGAGAAAGCTCAAGCCCATCCCCACTAAACTTA
G
G
A
G
A
A
A
G
C
T
C
A
A
G
C
C
C
A
T
C
C
C
C
A
C
T
A
A
A
C
T
T
A
Genes: A2O7O5N5DGF

Composition

Corgi
18%
Labrador
18%
Dachshund
9%
Pug
9%
German Shepard
9%
Pitbull terrier
9%
Beagle
9%
Boxer
9%
Yorkshire Terrier
9%

Current Energy

Vitality -37 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Pug
Legs Corgi
Front Legs German Shepard
Head Corgi
Ears Labrador
Snout Pitbull terrier
Mouth Labrador
Nose Beagle
Eyes Boxer
Color Yorkshire Terrier

Parents

No Children

Photos

Gift