Zeke Zippy Digital Cryptocurrency Dog - Mix of Golder Retriever, Rottweiler, Labrador BK, Corgi, Shiba Inu and Beagle
Zeke Zippy
  • Purity 21%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Happy & Agile

Achievements

None

Bio

Hey, good-looking! This is Zeke Zippy. Someday I'm gonna breakout from inside this server. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'll outrun you for the ball if I can...that's just how I roll.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAAGAAGAAGAAGAAGCGTACTACACAGACAC
G
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
C
G
T
A
C
T
A
C
A
C
A
G
A
C
A
C
Genes: 68888OEDH8H

Composition

Golder Retriever
45%
Rottweiler
18%
Labrador BK
9%
Corgi
9%
Shiba Inu
9%
Beagle
9%

Current Energy

Vitality -28 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Beagle
Nose Rottweiler
Eyes Golder Retriever
Color Rottweiler